Mary When Jango's Helmet Flies Off

OK, guys. I posted this to the main discussion boards under Star Wars films, AOTC. I figured I'd post it here, as well in case folks don't regularly go out to the main discussion forum. Here's my question/thought.

When Jango is decapitated in the arena, is it just my imagination or does what's left above his shoulders look strangely like a pipe? It doesn't look like a neck to me, unless Lucas wanted us to see that Mace's lightsabre lopped of Jango's head down to the spinal cord (gross). It looks like a metal pipe, though, not a human body part, more like some kind of droid part. I've looked closely each time I've watched the movie and even though the shot only lasts for a split second each time I come to the same conclusion, that it looks like some kind of pipe. What do you guys think?

M.M.

 

I think it has to be his spine. After all, it would be futile to clone a droid.

 

goto

http://www.angelfire.com/sports1/ravensnest13/chop_copy.jpg

I think its his rocket from his rocketpack

(Sorry for the bad pic but best I could find)

Tak

 

Yeah, from that pic it looks like it's the jetpack.

Also, some claim to see Jango's head fly out of the helmet. On my fourth viewing (after reading about this rumor), I did see something fly out from the helmet.

 

Yeah, I think it's his jetpack, but it could be a pole used to hold the helmet as Samuel Jackson knocks it off. Could be a blooper.

The part where Jango's head comes out of his helmet, I have seen a shadow fly out as the helmet bounces back up off the ground. The helmet sort of spins and you see a shadow moving out along the end of the screen. How else would Boba be able to pick up the helmet wihtout a head plopping out. Unless it was fused into the helmet by the lightsaber.

 

For some pics of the rocketpack and head rolling shadow go Here and click on the "AOTC pics" link

Also if you click on the "My Photos" you will see my pics from the Senator ticket line and some opening night pics also

Enjoy

Tak

 

I think Jango has a robot of himself that the kaminoans built for him so he wouldnt get harmed. they would do this because they need him to keep making more clones of him. Bring on the flames!!

 

See? Now that's what I'm talking 'bout here. I saw the movie twice last weekend and I still can't help but think that what was holding on his head looks an awful lot like a pipe. I find that theory pretty interesting, Broadcastah.

 

Bigbroadcasta,
Nice theory, but remember that Boba is an exact duplicate of Jango with no advanced gene altering or life span altering. Therefore, the Kaminoans could continue their work with Boba as the host.

 

That's a novel point Mutt.

 

Once they had the genetic code from Jango they wouldn't need his help to make further clones. One of his demands for participation in the cloning process was an unaltered clone for himself (ie Boba).

The cloning people wouldn't need Jango or Boba for that matter to continue the cloning process.

I think Jango and Boba lived on the cloning planet as they had no where better to go.

M

 

No, the Fetts didn't just stay there for the heck of it. The Kaminoans said they kept the host around for reasons (I can't remember now, if they gave a reason at all). I would think that they would continually take samples of the hosts DNA and compare with the clone's developing genetics. The SW databank for Kaminoans states that they are a very perfectionist species. So like any engineer the Kaminoans would continually tweak the process to get even better results.

Remember, be mindful of the future, but not at the expense of the moment. In time all your questions and theories will be realized and you will call me Master.... uh a Darth moment...

 

erm, no.

Once you sequence DNA you don't have to repeat it as our DNA doesn't change. Hence they only needed to sequence him once.

M

 

"Once you sequence DNA you don't have to repeat it as our DNA doesn't change. Hence they only needed to sequence him once. "

Um, have you ever tried to make a copy of a VHS tape, and then tried to make a copy off of that? The copy degrades considerably.

Also, sequencing just tells you what the raw material is made of and what sections of that material do what, it doesn't allow you to spontaneously create the raw material, as in the DNA strands.

 

I'm sorry, but sequencing DNA bares no comparison to copying a VHS video tape. You maybe need a little help with your biology.

Your DNA is made up of four bases, arranged into two base pairs (adenine-thymine, or cytosine-guanine). These base pairs are grouped in sets of three (called a codon) along a strand of DNA. Seeing that there are 4 bases, and 3 bases per codon, you can have 64 possible condons. Of these 64 combinations, only 21 are used to encode specific amino-acids, which are further grouped together to form proteins that more or less form the entire structure of the human body.

A sequence of DNA is actually very simple (only four bases), so when you sequence a strand of DNA you get its exact configuration - no errors.

Once you have a strand of DNA (isolated from any cell you like) you perform RT-PCR (reverse transcriptase polmerase chain reaction) which perfectly copies the strand of DNA many many times. The sequencer equipment then uses a collection of enzymes to separate and unwind the copied DNA. Molecular probes specific for each base are added which attach to their appropriate base and give off a specific signal which is recorded by the sequencer giving you the exact sequence of base pairs in the strand of DNA.

In reality what you get is a very long (thousands) of A,T,C and Gs (which you can compare to other strands of DNA for homology) or create your own strand of complimentary DNA by (ie cloning).

ATCTCGATCGATCGCGATCGCTATTTCCGATCGTACG

When we scientists clone DNA we only need to do it once. It gives us the ability to clone a short DNA section, or an entire protein, and even now adays an whole animal.

Everyone knows Dolly the sheep who is a perfect clone of her mother.


M

 

"Also, sequencing just tells you what the raw material is made of and what sections of that material do what, it doesn't allow you to spontaneously create the raw material, as in the DNA strands."

Actually, sequencing doesn't tell you what the raw material is made of. To find out what the raw material is made of (ie the presence and orientiation of carbon, hydrogen and other important atoms) you would need to use Mass Spectometry.
(I won't go into explaining how that works)

RT-PCR (see above post) *does* let you spontaneously create new strands of DNA
Although its not exactly spontaneous - it requires a modestly expensive PCR machine, the correct enzymes and a few hours.

M

 

Dolly the clone is by no means a perfect copy as vets are having a lot of medical problems with her. Cloning is a process we humans have not perfected as we can not achieve 100% efficiency in production.

 

ok, "perfect" copy was a bad word. "Exact" copy would have been much better as thats what Dolly is. Her mother had the same medical conditions as Dolly has.

We will soon have the ability to fully edit the cloning process allowing us to prevent various genetic disorders. While this is an exciting medical breakthrough, it does however have the worry that certain groups might try to harness the technique to build the perfect human

Many scientists work with genetically engineered rodents. Its possible to prevent a rodent from generating specific proteins during its development (a process known as "knock-outs") to see what effect that particular protein has on the rodents physiology. Another technique involves the addition of a new protein into the rodents genome to see what effect it has.

M

 

Most scientist would say a low or negiligable percentage of error, but no errors?

Though I do see your point that once you have the code, the original code doesn't change. Though there may be more factors in cloning than just DNA, because Dolly's medical problems do not stem from problems she inherited from her clone mother.

 

You can check for errors as when you copy DNA you make two at the same time which you compare (we have computer software that does it for us).

After you RTPCR the DNA you do go through a purification process which ensures that you only sequence the original DNA.

So, the bottom line is that its relatively easy to create an exact copy of a strand of DNA. Its just as easy to copy an amino-acid sequence and even entire proteins.
However, our cloning of an entire animal may not be perfect as yet given that we don't know the long term effects of cloning.

I think the ill health of Dolly is because she was a clone from a fully grown sheep, so she has effectively had a lot longer to develope diseases. Her genetics have now had two lives, whereas her body has only had one. (does that make sense?)

I'm sure the cloning people in ATOC have much better equipment and techniques than we do.

Anyways, its science-fiction folks

M

interesting debate - even if its slightly off topic - but, the negative long term effects of cloning are possibly why the Storm Troopers are abit daft, and why Boba Fett is such a headcase (maybe)

 

that would be awesome to make a pipe out of Jango Fett! In fact, sounds like a challenge! Pls excuse me from the boards for a few more weeks while I try to smoke out of Jango's spinal cord!